Review



primer: dcx-dsred forward  (Jackson Laboratory)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 90
      Buy from Supplier

    Structured Review

    Jackson Laboratory primer: dcx-dsred forward

    Primer: Dcx Dsred Forward, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/primer%3A+dcx-dsred+forward/pmc09307679-54-0-5?v=Jackson+Laboratory
    Average 90 stars, based on 1 article reviews
    primer: dcx-dsred forward - by Bioz Stars, 2026-07
    90/100 stars

    Images

    1) Product Images from "Protocol to photoactivate adipose-derived stem cell differentiation using a tightly-focused femtosecond laser"

    Article Title: Protocol to photoactivate adipose-derived stem cell differentiation using a tightly-focused femtosecond laser

    Journal: STAR Protocols

    doi: 10.1016/j.xpro.2022.101574


    Figure Legend Snippet:

    Techniques Used: Recombinant, In Vivo, Isolation, Plasmid Preparation, Software, Cell Culture, Microscopy



    Similar Products

    primer: dcx-dsred forward  (Jackson Laboratory)
    90
    Jackson Laboratory primer: dcx-dsred forward

    Primer: Dcx Dsred Forward, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/primer%3A+dcx-dsred+forward/pmc09307679-54-0-5?v=Jackson+Laboratory
    Average 90 stars, based on 1 article reviews
    primer: dcx-dsred forward - by Bioz Stars, 2026-07
    90/100 stars
    		  Buy from Supplier
    dcx-dsred forward primer  (Jackson Laboratory)
    90
    Jackson Laboratory dcx-dsred forward primer

    Dcx Dsred Forward Primer, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/primer%3A+dcx-dsred+forward/pmc09307679-56-0-6?v=Jackson+Laboratory
    Average 90 stars, based on 1 article reviews
    dcx-dsred forward primer - by Bioz Stars, 2026-07
    90/100 stars
    		  Buy from Supplier

    Image Search Results


    Journal: STAR Protocols

    Article Title: Protocol to photoactivate adipose-derived stem cell differentiation using a tightly-focused femtosecond laser

    doi: 10.1016/j.xpro.2022.101574

    Figure Lengend Snippet:

    Article Snippet: Primer: Dcx-DsRed Forward: CCCATGGTCTTCTTCTGCAT , The Jackson Laboratory , N/A.

    Techniques: Recombinant, In Vivo, Isolation, Plasmid Preparation, Software, Cell Culture, Microscopy

    Journal: STAR Protocols

    Article Title: Protocol to photoactivate adipose-derived stem cell differentiation using a tightly-focused femtosecond laser

    doi: 10.1016/j.xpro.2022.101574

    Figure Lengend Snippet:

    Article Snippet: Primer: Dcx-DsRed Internal Positive Forward:CTAGGCCACAGAATTGAAAGATCT , The Jackson Laboratory , N/A.

    Techniques: Recombinant, In Vivo, Isolation, Plasmid Preparation, Software, Cell Culture, Microscopy